Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTTTAAATACATTATATTCATTCCT[C/T]TCAATTTGATAATAATCACTTGAGA
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 608534 MIM: 606042 MIM: 602322 | |||||||||||||||||||||||
Literature Links: |
ACTRT3 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
ACTRT3 - actin related protein T3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MYNN - myoneurin | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001185118.1 | Intron | NP_001172047.1 | ||||
NM_001185119.1 | Intron | NP_001172048.1 | ||||
NM_018657.4 | Intron | NP_061127.1 | ||||
XM_005247621.4 | Intron | XP_005247678.1 | ||||
XM_005247622.3 | Intron | XP_005247679.1 | ||||
XM_005247624.3 | Intron | XP_005247681.1 | ||||
XM_011512987.1 | Intron | XP_011511289.1 | ||||
XM_017006864.1 | Intron | XP_016862353.1 | ||||
XM_017006865.1 | Intron | XP_016862354.1 | ||||
XM_017006866.1 | Intron | XP_016862355.1 | ||||
XM_017006867.1 | Intron | XP_016862356.1 | ||||
XM_017006868.1 | Intron | XP_016862357.1 |
TERC - telomerase RNA component | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |