Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGCTCAGCCTGATTATCCATCTTCT[G/T]GGCTAGACCTTTTTGCTAGCACCTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604872 MIM: 600818 | ||||||||||||||||||||
Literature Links: |
LOC100652768 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC100652768 - uncharacterized LOC100652768 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCSK7 - proprotein convertase subtilisin/kexin type 7 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004716.3 | Intron | NP_004707.2 | ||||
XM_006718940.3 | Intron | XP_006719003.1 | ||||
XM_017018546.1 | Intron | XP_016874035.1 |
TAGLN - transgelin | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |