Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGAGGGAATGTGCAGGAACAGAGGC[A/G]TCTTCCTGGGTTTGGCTCCCCGTTC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 612844 MIM: 602695 MIM: 604472 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
SENP3 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
SENP3 - SUMO1/sentrin/SMT3 specific peptidase 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SENP3-EIF4A1 - SENP3-EIF4A1 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TNFSF12 - tumor necrosis factor superfamily member 12 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TNFSF12-TNFSF13 - TNFSF12-TNFSF13 readthrough | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_172089.3 | 1609 | UTR 3 | NP_742086.1 |
TNFSF13 - tumor necrosis factor superfamily member 13 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001198622.1 | 1609 | UTR 3 | NP_001185551.1 | |||
NM_001198623.1 | 1609 | UTR 3 | NP_001185552.1 | |||
NM_001198624.1 | 1609 | UTR 3 | NP_001185553.1 | |||
NM_003808.3 | 1609 | UTR 3 | NP_003799.1 | |||
NM_172087.2 | 1609 | UTR 3 | NP_742084.1 | |||
NM_172088.2 | 1609 | Intron | NP_742085.1 |