Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCCGGGCAGCCCCTCCCCTGACCC[C/G]TGCGCTCGCAGCCCCCTCGCCAGAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
BAHCC1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BAHCC1 - BAH domain and coiled-coil containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001291324.1 | Intron | NP_001278253.1 | ||||
XM_011525063.2 | Intron | XP_011523365.1 | ||||
XM_017024898.1 | Intron | XP_016880387.1 | ||||
XM_017024899.1 | Intron | XP_016880388.1 |
LOC100130370 - uncharacterized LOC100130370 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR4740 - microRNA 4740 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |