Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGAAAAGTAAGTTACTTTGTCACTG[C/T]CCATCTTCTAGCACTTTATGTTTCC
Species: |
Human | ||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||
Phenotype: |
MIM: 611605 | ||||||||||||||||||||||||||
Literature Links: |
ERLIN2 PubMed Links | ||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba)
|
|||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese)
|
|||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
ERLIN2 - ER lipid raft associated 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001003790.3 | Intron | NP_001003790.1 | ||||
NM_001003791.2 | Intron | NP_001003791.1 | ||||
NM_007175.6 | Intron | NP_009106.1 | ||||
XM_005273392.2 | Intron | XP_005273449.1 | ||||
XM_006716280.2 | Intron | XP_006716343.1 | ||||
XM_017013000.1 | Intron | XP_016868489.1 |
LOC101929622 - uncharacterized LOC101929622 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC102723701 - uncharacterized LOC102723701 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC728024 - chromosome X open reading frame 56 pseudogene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |