Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCAATTTACCTGGTTTCCTGCTCCA[C/T]GGATGACAACTTTAGTAGAGGCTGA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 608011 MIM: 610358 | ||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
GLT8D1 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | ||||||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | ||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
GLT8D1 - glycosyltransferase 8 domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001010983.2 | 860 | Missense Mutation | CAT,CGT | H,R 210 | NP_001010983.1 | |
NM_001278280.1 | 860 | Missense Mutation | CAT,CGT | H,R 210 | NP_001265209.1 | |
NM_001278281.1 | 860 | Missense Mutation | CAT,CGT | H,R 210 | NP_001265210.1 | |
NM_018446.3 | 860 | Missense Mutation | CAT,CGT | H,R 210 | NP_060916.1 | |
NM_152932.2 | 860 | Missense Mutation | CAT,CGT | H,R 210 | NP_690909.1 | |
XM_017006857.1 | 860 | Missense Mutation | CAT,CGT | H,R 210 | XP_016862346.1 | |
XM_017006858.1 | 860 | Missense Mutation | CAT,CGT | H,R 210 | XP_016862347.1 | |
XM_017006859.1 | 860 | Missense Mutation | CAT,CGT | H,R 210 | XP_016862348.1 |
GNL3 - G protein nucleolar 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD136 - small nucleolar RNA, C/D box 136 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD19 - small nucleolar RNA, C/D box 19 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD19B - small nucleolar RNA, C/D box 19B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD69 - small nucleolar RNA, C/D box 69 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SPCS1 - signal peptidase complex subunit 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |