Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCAGATTAACTTCCCTGCATGTGTA[C/T]GGGCTTTAATGAAGCCCTGTAAGAG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
48 submissions
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 606006 MIM: 612072 MIM: 611974 MIM: 606521 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
GGA3 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
Global
|
Caucasian
|
CEPH (CEU)
|
|||||||||
EAS
|
African American
|
YRI (Yoruba)
|
|||||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
|||||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
|||||||||
EUR
|
|||||||||||
AMR
|
GGA3 - golgi associated, gamma adaptin ear containing, ARF binding protein 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001172703.2 | Intron | NP_001166174.1 | ||||
NM_001172704.2 | Intron | NP_001166175.1 | ||||
NM_001291641.1 | Intron | NP_001278570.1 | ||||
NM_001291642.1 | Intron | NP_001278571.1 | ||||
NM_014001.4 | Intron | NP_054720.1 | ||||
NM_138619.3 | Intron | NP_619525.1 | ||||
XM_011524563.2 | Intron | XP_011522865.1 | ||||
XM_017024385.1 | Intron | XP_016879874.1 | ||||
XM_017024386.1 | Intron | XP_016879875.1 | ||||
XM_017024387.1 | Intron | XP_016879876.1 | ||||
XM_017024388.1 | Intron | XP_016879877.1 | ||||
XM_017024389.1 | Intron | XP_016879878.1 | ||||
XM_017024390.1 | Intron | XP_016879879.1 | ||||
XM_017024391.1 | Intron | XP_016879880.1 | ||||
XM_017024392.1 | Intron | XP_016879881.1 |
LOC100287042 - uncharacterized LOC100287042 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIF4GD - MIF4G domain containing | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MRPS7 - mitochondrial ribosomal protein S7 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_015971.3 | Intron | NP_057055.2 |
SLC25A19 - solute carrier family 25 member 19 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap JSNP Validated |