Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTTCAAACTGAGAAGAATCCTATTC[A/C]GCACGCTTCTCCTCCTGAGGTGGTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
10 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 611923 MIM: 606535 MIM: 608267 | ||||||||||||||||||||
Literature Links: |
GJA9 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GJA9 - gap junction protein alpha 9 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GJA9-MYCBP - GJA9-MYCBP readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC105378663 - uncharacterized LOC105378663 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MYCBP - MYC binding protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_012333.4 | Intron | NP_036465.2 |
RRAGC - Ras related GTP binding C | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |