Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GACTACACATCTGGCCTCCTCCCAG[C/T]TGGAGTGGCCAAAATTGTAAATCAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607289 MIM: 609206 | ||||||||||||||||||||
Literature Links: |
BLOC1S5 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BLOC1S5 - biogenesis of lysosomal organelles complex 1 subunit 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
BLOC1S5-TXNDC5 - BLOC1S5-TXNDC5 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
EEF1E1 - eukaryotic translation elongation factor 1 epsilon 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001135650.1 | Intron | NP_001129122.1 | ||||
NM_004280.4 | Intron | NP_004271.1 |
EEF1E1-BLOC1S5 - EEF1E1-BLOC1S5 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |