Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCAACAAAAATCCACCCTACACAT[A/C]TTAAACATCACTGAACAAAACTGCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602892 MIM: 602893 | ||||||||||||||||||||
Literature Links: |
KLRC3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
KLRC3 - killer cell lectin like receptor C3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KLRC4 - killer cell lectin like receptor C4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_013431.2 | Intron | NP_038459.1 |
KLRC4-KLRK1 - KLRC4-KLRK1 readthrough | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001199805.1 | Intron | NP_001186734.1 |
LOC101928100 - uncharacterized LOC101928100 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |