Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCAAAGTTATTAGCAACATGTAAAA[C/T]ACTTAAATACCATTAGTTATGCAAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 610304 MIM: 614405 | ||||||||||||||||||||
Literature Links: |
DERL2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DERL2 - derlin 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001304777.1 | 2472 | UTR 3 | NP_001291706.1 | |||
NM_001304779.1 | 2472 | UTR 3 | NP_001291708.1 | |||
NM_016041.4 | 2472 | UTR 3 | NP_057125.2 |
DHX33 - DEAH-box helicase 33 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC105371506 - uncharacterized LOC105371506 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |