Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TAGGGGCAGTACCCATAGACTCCCC[G/T]CTCTGCACACCATTCGGGGGCCTCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 186946 MIM: 600230 MIM: 601140 | ||||||||||||||||||||
Literature Links: |
FKBP2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FKBP2 - FK506 binding protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC105369340 - uncharacterized LOC105369340 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PLCB3 - phospholipase C beta 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000932.2 | Intron | NP_000923.1 | ||||
NM_001184883.1 | Intron | NP_001171812.1 | ||||
NM_001316314.1 | Intron | NP_001303243.1 | ||||
XM_011545101.2 | Intron | XP_011543403.1 | ||||
XM_017017925.1 | Intron | XP_016873414.1 |
PPP1R14B - protein phosphatase 1 regulatory inhibitor subunit 14B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |