Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTGCACAGTGGGCCTGCGTGGGCG[T/C]GGTGCGGGGCAACTGCCCATGGAGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
45 submissions
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 615183 MIM: 176982 | ||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
FAAP20 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
FAAP20 - Fanconi anemia core complex associated protein 20 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001146310.1 | 251 | Intron | NP_001139782.1 | |||
NM_001256945.1 | 251 | Intron | NP_001243874.1 | |||
NM_001256946.1 | 251 | Intron | NP_001243875.1 | |||
NM_001256947.1 | 251 | Intron | NP_001243876.1 | |||
NM_001282670.1 | 251 | Intron | NP_001269599.1 | |||
NM_001282671.1 | 251 | UTR 5 | NP_001269600.1 | |||
NM_001282672.1 | 251 | UTR 5 | NP_001269601.1 | |||
NM_001282673.1 | 251 | Intron | NP_001269602.1 | |||
NM_182533.2 | 251 | Intron | NP_872339.2 | |||
XM_006710419.3 | 251 | Intron | XP_006710482.1 | |||
XM_006710421.3 | 251 | Intron | XP_006710484.1 | |||
XM_011540914.2 | 251 | Intron | XP_011539216.1 | |||
XM_011540921.2 | 251 | Intron | XP_011539223.1 | |||
XM_011540922.1 | 251 | Intron | XP_011539224.1 | |||
XM_017000553.1 | 251 | Intron | XP_016856042.1 | |||
XM_017000554.1 | 251 | Intron | XP_016856043.1 | |||
XM_017000555.1 | 251 | UTR 5 | XP_016856044.1 | |||
XM_017000556.1 | 251 | UTR 5 | XP_016856045.1 | |||
XM_017000557.1 | 251 | Intron | XP_016856046.1 |
LOC100506504 - uncharacterized LOC100506504 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRKCZ - protein kinase C zeta | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |