Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCGTTCCCGGCTCCCAGGGCCCGTC[G/T]GTCCCCCGGGAGCCCTGGAGGCGCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611453 MIM: 610272 | ||||||||||||||||||||
Literature Links: |
DBNDD2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DBNDD2 - dysbindin domain containing 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001048221.2 | 27 | Intron | NP_001041686.1 | |||
NM_001048222.2 | 27 | Intron | NP_001041687.1 | |||
NM_001048223.2 | 27 | UTR 5 | NP_001041688.1 | |||
NM_001048224.2 | 27 | UTR 5 | NP_001041689.1 | |||
NM_001048225.2 | 27 | Intron | NP_001041690.2 | |||
NM_001048226.2 | 27 | Intron | NP_001041691.2 | |||
NM_001197139.1 | 27 | Intron | NP_001184068.1 | |||
NM_001197140.1 | 27 | Intron | NP_001184069.1 | |||
NM_018478.3 | 27 | Intron | NP_060948.3 |
PIGT - phosphatidylinositol glycan anchor biosynthesis class T | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SYS1-DBNDD2 - SYS1-DBNDD2 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |