Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CATTTATGTAGAAACACATCAAGCA[A/C]CTTTTCTCCCCGCTATGGATGACTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608387 | ||||||||||||||||||||
Literature Links: |
CASP16P PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CASP16P - caspase 16, pseudogene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNF213 - zinc finger protein 213 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001134655.1 | Intron | NP_001128127.1 | ||||
NM_004220.2 | Intron | NP_004211.1 | ||||
XM_011522652.2 | Intron | XP_011520954.1 |
ZNF213-AS1 - ZNF213 antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |