Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCATGAGTTTTTGTTTCATTTATA[A/C]GTAGTTTATTTACATATTTGATCAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605962 | ||||||||||||||||||||
Literature Links: |
LOC105376271 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC105376271 - uncharacterized LOC105376271 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RABEPK - Rab9 effector protein with kelch motifs | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001174152.1 | Intron | NP_001167623.1 | ||||
NM_001174153.1 | Intron | NP_001167624.1 | ||||
NM_005833.3 | Intron | NP_005824.2 | ||||
XM_005251640.4 | Intron | XP_005251697.1 | ||||
XM_005251641.4 | Intron | XP_005251698.1 | ||||
XM_005251642.4 | Intron | XP_005251699.1 | ||||
XM_005251644.4 | Intron | XP_005251701.1 | ||||
XM_011518120.2 | Intron | XP_011516422.1 | ||||
XM_017014177.1 | Intron | XP_016869666.1 | ||||
XM_017014178.1 | Intron | XP_016869667.1 | ||||
XM_017014179.1 | Intron | XP_016869668.1 | ||||
XM_017014180.1 | Intron | XP_016869669.1 | ||||
XM_017014181.1 | Intron | XP_016869670.1 | ||||
XM_017014182.1 | Intron | XP_016869671.1 | ||||
XM_017014183.1 | Intron | XP_016869672.1 |