Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCTCTCTGCACAGTGCATCCCAGA[C/G]CCCATCTTTCTCATATTGGTTGTGA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 613358 MIM: 600007 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ALDH16A1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ALDH16A1 - aldehyde dehydrogenase 16 family member A1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FLT3LG - fms related tyrosine kinase 3 ligand | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001204502.1 | Intron | NP_001191431.1 | ||||
NM_001204503.1 | Intron | NP_001191432.1 | ||||
NM_001278637.1 | Intron | NP_001265566.1 | ||||
NM_001278638.1 | Intron | NP_001265567.1 | ||||
NM_001459.3 | Intron | NP_001450.2 | ||||
XM_005258680.4 | Intron | XP_005258737.3 | ||||
XM_005258681.4 | Intron | XP_005258738.3 | ||||
XM_005258682.4 | Intron | XP_005258739.3 | ||||
XM_005258683.4 | Intron | XP_005258740.3 | ||||
XM_006723116.3 | Intron | XP_006723179.2 | ||||
XM_011526675.2 | Intron | XP_011524977.1 | ||||
XM_011526676.2 | Intron | XP_011524978.1 | ||||
XM_011526677.2 | Intron | XP_011524979.1 | ||||
XM_011526678.2 | Intron | XP_011524980.1 | ||||
XM_011526680.2 | Intron | XP_011524982.1 | ||||
XM_011526682.2 | Intron | XP_011524984.1 | ||||
XM_017026532.1 | Intron | XP_016882021.1 | ||||
XM_017026533.1 | Intron | XP_016882022.1 | ||||
XM_017026534.1 | Intron | XP_016882023.1 | ||||
XM_017026535.1 | Intron | XP_016882024.1 |
RPL13A - ribosomal protein L13a | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |