Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGGACAGAATTTCTGGGCGGAAGCC[A/C]GCAGGTGGGCCCAAAGGGCACCTGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 614478 MIM: 138420 MIM: 601735 | ||||||||||||||||||||
Literature Links: |
COX14 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
COX14 - COX14, cytochrome c oxidase assembly factor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GPD1 - glycerol-3-phosphate dehydrogenase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001257199.1 | Intron | NP_001244128.1 | ||||
NM_005276.3 | Intron | NP_005267.2 |
SMARCD1 - SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |