Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGACCCAACCCAGGTTTTGGAGGC[C/T]GGCCCCCACCCCCAGGGAAACTCCG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 606493 MIM: 614777 MIM: 616750 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
EXOSC1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
EXOSC1 - exosome component 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MMS19 - MMS19 homolog, cytosolic iron-sulfur assembly component | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZDHHC16 - zinc finger DHHC-type containing 16 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001287803.1 | Intron | NP_001274732.1 | ||||
NM_001287804.1 | Intron | NP_001274733.1 | ||||
NM_032327.3 | Intron | NP_115703.2 | ||||
NM_198043.2 | Intron | NP_932160.1 | ||||
NM_198044.2 | Intron | NP_932161.1 | ||||
NM_198045.2 | Intron | NP_932162.1 | ||||
NM_198046.2 | Intron | NP_932163.1 | ||||
XM_006718021.1 | Intron | XP_006718084.1 | ||||
XM_006718022.1 | Intron | XP_006718085.1 | ||||
XM_006718023.1 | Intron | XP_006718086.1 | ||||
XM_006718024.1 | Intron | XP_006718087.1 | ||||
XM_006718025.1 | Intron | XP_006718088.1 | ||||
XM_006718026.1 | Intron | XP_006718089.1 | ||||
XM_017016766.1 | Intron | XP_016872255.1 | ||||
XM_017016767.1 | Intron | XP_016872256.1 | ||||
XM_017016768.1 | Intron | XP_016872257.1 | ||||
XM_017016769.1 | Intron | XP_016872258.1 | ||||
XM_017016770.1 | Intron | XP_016872259.1 | ||||
XM_017016771.1 | Intron | XP_016872260.1 | ||||
XM_017016772.1 | Intron | XP_016872261.1 | ||||
XM_017016773.1 | Intron | XP_016872262.1 | ||||
XM_017016774.1 | Intron | XP_016872263.1 |