Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATCTCTCTACATAGTCTCCACCTGC[A/G]TGGGCACAGGATGTTCTCCTCACCT
Species: |
Human | ||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||
Phenotype: |
MIM: 615556 MIM: 603405 | ||||||||||||||||||||||||||
Literature Links: |
ATAT1 PubMed Links | ||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU)
|
|||
EAS - Not Available | African American - Not Available | YRI (Yoruba)
|
|||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
ATAT1 - alpha tubulin acetyltransferase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
C6orf136 - chromosome 6 open reading frame 136 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
DHX16 - DEAH-box helicase 16 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001164239.1 | Intron | NP_001157711.1 | ||||
NM_003587.4 | Intron | NP_003578.2 | ||||
XM_011514938.2 | Intron | XP_011513240.1 | ||||
XM_011514939.2 | Intron | XP_011513241.1 | ||||
XM_011514940.2 | Intron | XP_011513242.1 | ||||
XM_011514941.2 | Intron | XP_011513243.1 |
Set Membership: |
HapMap |