Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGGCGGGGCCGTACCCGGCGGTTGG[C/T]GAAGGGCGAGCGGAGGGCTGGGCCT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 604850 MIM: 611654 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
COPS5 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
COPS5 - COP9 signalosome subunit 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CSPP1 - centrosome and spindle pole associated protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001291339.1 | 354 | Intron | NP_001278268.1 | |||
NM_024790.6 | 354 | Intron | NP_079066.5 | |||
XM_005251305.3 | 354 | Nonsense Mutation | CGA,TGA | R,* 28 | XP_005251362.2 | |
XM_006716474.2 | 354 | Nonsense Mutation | CGA,TGA | R,* 28 | XP_006716537.2 | |
XM_006716477.2 | 354 | Nonsense Mutation | CGA,TGA | R,* 28 | XP_006716540.2 | |
XM_011517598.1 | 354 | Nonsense Mutation | CGA,TGA | R,* 28 | XP_011515900.1 | |
XM_011517599.1 | 354 | Nonsense Mutation | CGA,TGA | R,* 28 | XP_011515901.1 | |
XM_011517600.1 | 354 | Nonsense Mutation | CGA,TGA | R,* 28 | XP_011515902.1 | |
XM_011517601.1 | 354 | Nonsense Mutation | CGA,TGA | R,* 28 | XP_011515903.1 | |
XM_011517602.1 | 354 | Nonsense Mutation | CGA,TGA | R,* 28 | XP_011515904.1 | |
XM_011517603.1 | 354 | Intron | XP_011515905.1 | |||
XM_011517607.1 | 354 | Intron | XP_011515909.1 | |||
XM_011517608.1 | 354 | Intron | XP_011515910.1 | |||
XM_011517609.1 | 354 | Intron | XP_011515911.1 | |||
XM_011517611.2 | 354 | Intron | XP_011515913.1 | |||
XM_017013847.1 | 354 | Nonsense Mutation | CGA,TGA | R,* 28 | XP_016869336.1 | |
XM_017013848.1 | 354 | Nonsense Mutation | CGA,TGA | R,* 28 | XP_016869337.1 | |
XM_017013849.1 | 354 | Nonsense Mutation | CGA,TGA | R,* 28 | XP_016869338.1 | |
XM_017013850.1 | 354 | Nonsense Mutation | CGA,TGA | R,* 28 | XP_016869339.1 | |
XM_017013851.1 | 354 | Intron | XP_016869340.1 | |||
XM_017013852.1 | 354 | Nonsense Mutation | CGA,TGA | R,* 28 | XP_016869341.1 | |
XM_017013853.1 | 354 | Intron | XP_016869342.1 | |||
XM_017013854.1 | 354 | Nonsense Mutation | CGA,TGA | R,* 28 | XP_016869343.1 | |
XM_017013855.1 | 354 | Nonsense Mutation | CGA,TGA | R,* 28 | XP_016869344.1 | |
XM_017013856.1 | 354 | Intron | XP_016869345.1 | |||
XM_017013857.1 | 354 | Intron | XP_016869346.1 | |||
XM_017013858.1 | 354 | Intron | XP_016869347.1 | |||
XM_017013859.1 | 354 | Intron | XP_016869348.1 |