Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTGTCCACATAAAGGAGTGGAGCC[C/T]GGTCCCCCTCCAGGGAGGGGAAAGA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 609336 MIM: 603913 MIM: 602697 MIM: 607793 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ANGPTL6 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ANGPTL6 - angiopoietin like 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
EIF3G - eukaryotic translation initiation factor 3 subunit G | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
P2RY11 - purinergic receptor P2Y11 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002566.4 | Intron | NP_002557.2 |
PPAN - peter pan homolog (Drosophila) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PPAN-P2RY11 - PPAN-P2RY11 readthrough | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001040664.2 | Intron | NP_001035754.1 | ||||
NM_001198690.1 | Intron | NP_001185619.1 |
SNORD105 - small nucleolar RNA, C/D box 105 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD105B - small nucleolar RNA, C/D box 105B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |