Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATCCTCCTGGTGGTGGGAGGGTCTC[C/T]CATTTTCTCTTTCCTTGCTATTCCG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
20 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 602979 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
A3GALT2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
A3GALT2 - alpha 1,3-galactosyltransferase 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR3605 - microRNA 3605 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PHC2 - polyhomeotic homolog 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004427.3 | Intron | NP_004418.2 | ||||
NM_198040.2 | Intron | NP_932157.1 | ||||
XM_005270570.1 | Intron | XP_005270627.1 | ||||
XM_011540876.2 | Intron | XP_011539178.1 | ||||
XM_011540877.2 | Intron | XP_011539179.1 | ||||
XM_011540878.2 | Intron | XP_011539180.1 | ||||
XM_017000513.1 | Intron | XP_016856002.1 | ||||
XM_017000514.1 | Intron | XP_016856003.1 | ||||
XM_017000515.1 | Intron | XP_016856004.1 | ||||
XM_017000516.1 | Intron | XP_016856005.1 | ||||
XM_017000517.1 | Intron | XP_016856006.1 | ||||
XM_017000518.1 | Intron | XP_016856007.1 | ||||
XM_017000519.1 | Intron | XP_016856008.1 | ||||
XM_017000520.1 | Intron | XP_016856009.1 | ||||
XM_017000521.1 | Intron | XP_016856010.1 | ||||
XM_017000522.1 | Intron | XP_016856011.1 |