Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCAATGAACGGGGAATTGGCCAAGC[C/T]ACACACAGGTTCACCTTTTCCCAGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602848 MIM: 603462 MIM: 605664 | ||||||||||||||||||||
Literature Links: |
BRD8 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BRD8 - bromodomain containing 8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CDC23 - cell division cycle 23 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KIF20A - kinesin family member 20A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005733.2 | 847 | Silent Mutation | GCC,GCT | A,A 117 | NP_005724.1 |