Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGTCGCTGAGAGGTGGTTTGTTGG[G/T]GATGGGGAAAAGACTAGTGTAACAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 300253 MIM: 300564 | ||||||||||||||||||||
Literature Links: |
GPR173 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GPR173 - G protein-coupled receptor 173 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KANTR - KDM5C adjacent non-coding transcript | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TSPYL2 - TSPY like 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_022117.3 | Intron | NP_071400.1 | ||||
XM_006724592.3 | Intron | XP_006724655.1 | ||||
XM_017029726.1 | Intron | XP_016885215.1 | ||||
XM_017029727.1 | Intron | XP_016885216.1 |