Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGTCACGGACCCCAACACATACCA[A/G]TCTCTGCAGGCTCCATCTCAACTTG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 606715 MIM: 615495 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ASIC4 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ASIC4 - acid sensing ion channel subunit family member 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GMPPA - GDP-mannose pyrophosphorylase A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_013335.3 | Intron | NP_037467.2 | ||||
NM_205847.2 | Intron | NP_995319.1 | ||||
XM_005246483.3 | Intron | XP_005246540.1 | ||||
XM_005246486.3 | Intron | XP_005246543.1 | ||||
XM_011511032.2 | Intron | XP_011509334.1 | ||||
XM_017003906.1 | Intron | XP_016859395.1 | ||||
XM_017003907.1 | Intron | XP_016859396.1 | ||||
XM_017003908.1 | Intron | XP_016859397.1 | ||||
XM_017003909.1 | Intron | XP_016859398.1 | ||||
XM_017003910.1 | Intron | XP_016859399.1 | ||||
XM_017003911.1 | Intron | XP_016859400.1 | ||||
XM_017003912.1 | Intron | XP_016859401.1 | ||||
XM_017003913.1 | Intron | XP_016859402.1 | ||||
XM_017003914.1 | Intron | XP_016859403.1 | ||||
XM_017003915.1 | Intron | XP_016859404.1 | ||||
XM_017003916.1 | Intron | XP_016859405.1 | ||||
XM_017003917.1 | Intron | XP_016859406.1 |
LOC100996693 - CAVP-target protein-like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |