Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAAAGCCCTGGGAGCCCAGTCTCCC[C/T]TGACTGGAGATTGTGTAATTCATCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611508 MIM: 610056 | ||||||||||||||||||||
Literature Links: |
CAMTA2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CAMTA2 - calmodulin binding transcription activator 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001171166.1 | Intron | NP_001164637.1 | ||||
NM_001171167.1 | Intron | NP_001164638.1 | ||||
NM_001171168.1 | Intron | NP_001164639.1 | ||||
NM_015099.3 | Intron | NP_055914.2 | ||||
XM_006721478.3 | Intron | XP_006721541.1 | ||||
XM_006721481.3 | Intron | XP_006721544.1 | ||||
XM_006721482.3 | Intron | XP_006721545.1 | ||||
XM_011523746.2 | Intron | XP_011522048.1 | ||||
XM_011523747.2 | Intron | XP_011522049.1 | ||||
XM_011523748.2 | Intron | XP_011522050.1 | ||||
XM_011523749.2 | Intron | XP_011522051.1 |
MIR6864 - microRNA 6864 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6865 - microRNA 6865 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SPAG7 - sperm associated antigen 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |