Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CATTAAAGTAAAATAAAACTTGATA[C/T]AATTTTCTGAAAAAAATTTAAAATA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601126 MIM: 603172 | ||||||||||||||||||||
Literature Links: |
MIR3136 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MIR3136 - microRNA 3136 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMF1 - TATA element modulatory factor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UBA3 - ubiquitin like modifier activating enzyme 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003968.3 | Intron | NP_003959.3 | ||||
NM_198195.1 | Intron | NP_937838.1 | ||||
XM_011534210.1 | Intron | XP_011532512.1 | ||||
XM_011534211.1 | Intron | XP_011532513.1 |