Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACATTTCAGTGTCAATGTATTTTAA[C/G]CTTCAGTGTGTTAAAACTCTGTTGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
CTC-338M12.4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CTC-338M12.4 - uncharacterized LOC101928649 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TRIM52 - tripartite motif containing 52 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_032765.2 | 2598 | Intron | NP_116154.1 | |||
XM_005266000.3 | 2598 | UTR 3 | XP_005266057.1 | |||
XM_017009991.1 | 2598 | Intron | XP_016865480.1 | |||
XM_017009992.1 | 2598 | UTR 3 | XP_016865481.1 | |||
XM_017009993.1 | 2598 | UTR 3 | XP_016865482.1 | |||
XM_017009994.1 | 2598 | UTR 3 | XP_016865483.1 |
TRIM52-AS1 - TRIM52 antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |