Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCCCCACCACTTTCACCAGGCTTC[C/G]CAAGAGCACATTGGCATTTAAAGGA
Species: |
Human | ||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 177046 MIM: 170260 MIM: 170261 | ||||||||||||||||||||||||||||||||
Literature Links: |
PSMB8 PubMed Links | ||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian
|
CEPH (CEU) - Not Available | |||
EAS - Not Available | African American
|
YRI (Yoruba) - Not Available | |||
SAS - Not Available | Japanese
|
CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Chinese
|
JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
PSMB8 - proteasome subunit beta 8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PSMB8-AS1 - PSMB8 antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TAP1 - transporter 1, ATP binding cassette subfamily B member | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TAP2 - transporter 2, ATP binding cassette subfamily B member | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000544.3 | 939 | Missense Mutation | CGA,GGA | R,G 273 | NP_000535.3 | |
NM_001290043.1 | 939 | Missense Mutation | CGA,GGA | R,G 273 | NP_001276972.1 | |
NM_018833.2 | 939 | Missense Mutation | CGA,GGA | R,G 273 | NP_061313.2 |
Set Membership: |
DME Validated Inventoried |