Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCTGGGCACCCCAGGCCTTGCCTC[A/G]AGCTGCAGAGGCCACAAGACACTTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602711 MIM: 603483 MIM: 603819 | ||||||||||||||||||||
Literature Links: |
ANKHD1-EIF4EBP3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ANKHD1-EIF4EBP3 - ANKHD1-EIF4EBP3 readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
APBB3 - amyloid beta precursor protein binding family B member 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006051.3 | 1614 | Nonsense Mutation | CGA,TGA | R,* 428 | NP_006042.3 | |
NM_133172.2 | 1614 | Nonsense Mutation | CGA,TGA | R,* 426 | NP_573418.2 | |
NM_133173.2 | 1614 | Nonsense Mutation | CGA,TGA | R,* 421 | NP_573419.2 | |
NM_133174.2 | 1614 | Nonsense Mutation | CGA,TGA | R,* 419 | NP_573420.2 |
EIF4EBP3 - eukaryotic translation initiation factor 4E binding protein 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6831 - microRNA 6831 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC35A4 - solute carrier family 35 member A4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SRA1 - steroid receptor RNA activator 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001035235.3 | 1614 | Intron | NP_001030312.2 | |||
NM_001253764.1 | 1614 | Intron | NP_001240693.1 |