Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAGCAGGTCCTATAGACAGGCTGGG[C/T]ATTGAGTATCTTGTGTTCTCAGGGG
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 102645 MIM: 604020 MIM: 142408 | |||||||||||||||||||||||
Literature Links: |
APEH PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
APEH - acylaminoacyl-peptide hydrolase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001640.3 | Intron | NP_001631.3 | ||||
XM_005265097.2 | Intron | XP_005265154.1 | ||||
XM_005265098.4 | Intron | XP_005265155.1 | ||||
XM_011533658.2 | Intron | XP_011531960.1 | ||||
XM_011533659.1 | Intron | XP_011531961.1 | ||||
XM_011533660.2 | Intron | XP_011531962.1 | ||||
XM_011533661.2 | Intron | XP_011531963.1 | ||||
XM_011533662.2 | Intron | XP_011531964.1 | ||||
XM_011533663.2 | Intron | XP_011531965.1 | ||||
XM_017006285.1 | Intron | XP_016861774.1 | ||||
XM_017006286.1 | Intron | XP_016861775.1 |
BSN - bassoon presynaptic cytomatrix protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MST1 - macrophage stimulating 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |