Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTTCAGAACTGTAGCCTCCTCTCAC[C/T]GAAGGTGGGAGCTGCAGGAATCAGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
19 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 608917 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ATPAF1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ATPAF1 - ATP synthase mitochondrial F1 complex assembly factor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
EFCAB14 - EF-hand calcium binding domain 14 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
EFCAB14-AS1 - EFCAB14 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TEX38 - testis expressed 38 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001145474.3 | 735 | UTR 3 | NP_001138946.1 | |||
NM_001300863.1 | 735 | UTR 3 | NP_001287792.1 | |||
NM_001300864.1 | 735 | UTR 3 | NP_001287793.1 | |||
XM_011541421.2 | 735 | UTR 3 | XP_011539723.1 |