Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CACTAGTTGTAAACGTGGCCAGTGA[C/T]TGCCAACTCACAGACAGAAATTACT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 613131 MIM: 613132 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CDC20B PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CDC20B - cell division cycle 20B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001145734.2 | 275 | Intron | NP_001139206.2 | |||
NM_001170402.1 | 275 | Intron | NP_001163873.1 | |||
NM_152623.2 | 275 | Intron | NP_689836.2 | |||
XM_011543218.2 | 275 | Intron | XP_011541520.1 |
GPX8 - glutathione peroxidase 8 (putative) | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001008397.3 | 275 | Silent Mutation | GAC,GAT | D,D 78 | NP_001008398.2 | |
NM_001306197.1 | 275 | Silent Mutation | GAC,GAT | D,D 27 | NP_001293126.1 | |
NM_001306198.1 | 275 | Intron | NP_001293127.1 | |||
NM_001306201.1 | 275 | Intron | NP_001293130.1 | |||
XM_006714631.2 | 275 | Silent Mutation | GAC,GAT | D,D 79 | XP_006714694.1 |
MIR449A - microRNA 449a | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR449B - microRNA 449b | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |