Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAAGATGCTAGGATGTGTGACCCAA[A/T]GGAGCTTGTAGTTCGTCTGTGTGTC
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
||||||||||||||||||||||||
Literature Links: |
TCTEX1D2 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
TCTEX1D2 - Tctex1 domain containing 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TM4SF19 - transmembrane 4 L six family member 19 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001204897.1 | Intron | NP_001191826.1 | ||||
NM_001204898.1 | Intron | NP_001191827.1 | ||||
NM_138461.3 | Intron | NP_612470.2 |
TM4SF19-AS1 - TM4SF19 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TM4SF19-TCTEX1D2 - TM4SF19-TCTEX1D2 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |