Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGTAGGGCTTCTCTCCTGTATGGAC[A/G]CGCTGGTGCCGTTTCAGGTTATCCA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 606687 MIM: 605119 MIM: 605963 MIM: 613598 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
EIF2B4 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
EIF2B4 - eukaryotic translation initiation factor 2B subunit delta | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PPM1G - protein phosphatase, Mg2+/Mn2+ dependent 1G | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNX17 - sorting nexin 17 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001267059.1 | 1365 | Intron | NP_001253988.1 | |||
NM_001267060.1 | 1365 | Intron | NP_001253989.1 | |||
NM_001267061.1 | 1365 | Intron | NP_001253990.1 | |||
NM_014748.3 | 1365 | Intron | NP_055563.1 | |||
XM_011533203.1 | 1365 | Intron | XP_011531505.1 | |||
XM_017005405.1 | 1365 | Intron | XP_016860894.1 |
ZNF513 - zinc finger protein 513 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001201459.1 | 1365 | Silent Mutation | NP_001188388.1 | |||
NM_144631.5 | 1365 | Silent Mutation | NP_653232.3 | |||
XM_005264142.2 | 1365 | Silent Mutation | XP_005264199.1 | |||
XM_005264143.3 | 1365 | Silent Mutation | XP_005264200.1 |