Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTTCCCATCAAAGCTGCATTTCAT[G/T]TGGCCATGGGTACCTAGAAAGACAT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 606477 MIM: 611214 | ||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
SNORD91A PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | ||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | ||||||
AFR
|
Japanese - Not Available | JPT (Japanese)
|
||||||
EUR
|
||||||||
AMR
|
SNORD91A - small nucleolar RNA, C/D box 91A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD91B - small nucleolar RNA, C/D box 91B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SRR - serine racemase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001304803.1 | 2800 | UTR 3 | NP_001291732.1 | |||
NM_021947.2 | 2800 | UTR 3 | NP_068766.1 | |||
XM_006721565.3 | 2800 | UTR 3 | XP_006721628.1 | |||
XM_006721566.3 | 2800 | UTR 3 | XP_006721629.1 | |||
XM_011523974.2 | 2800 | UTR 3 | XP_011522276.1 |
TSR1 - TSR1, ribosome maturation factor | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_018128.4 | 2800 | Missense Mutation | CAA,CAC | Q,H 750 | NP_060598.3 |
Set Membership: |
HapMap |