Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGGTGGCTTGTGCCCAGCCCTACC[G/T]TGGACCCCACCTGTGGGCCTCCCTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611531 MIM: 611950 MIM: 612093 MIM: 612092 MIM: 610704 MIM: 176883 MIM: 615642 | ||||||||||||||||||||
Literature Links: |
EMG1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
EMG1 - EMG1, N1-specific pseudouridine methyltransferase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC105369635 - uncharacterized LOC105369635 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LPCAT3 - lysophosphatidylcholine acyltransferase 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR141 - microRNA 141 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR200C - microRNA 200c | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PHB2 - prohibitin 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001144831.1 | Intron | NP_001138303.1 | ||||
NM_001267700.1 | Intron | NP_001254629.1 |
PTPN6 - protein tyrosine phosphatase, non-receptor type 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SCARNA12 - small Cajal body-specific RNA 12 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |