Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAGCTGTATACCTGCCAGGAGCACA[C/T]ATGCACATTCATGTACCAACATGTA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
21 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 610742 MIM: 609957 MIM: 165380 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
FAM19A3 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
FAM19A3 - family with sequence similarity 19 member A3, C-C motif chemokine like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC105378910 - uncharacterized LOC105378910 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MOV10 - Mov10 RISC complex RNA helicase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PPM1J - protein phosphatase, Mg2+/Mn2+ dependent 1J | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005167.5 | Intron | NP_005158.5 |
RHOC - ras homolog family member C | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |