Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TACGAATGTTTTGATAATACTGAGG[A/G]AAAAAACCTCTCCCCTCCCCGTTAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607640 | ||||||||||||||||||||
Literature Links: |
ATXN7 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ATXN7 - ataxin 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PSMD6 - proteasome 26S subunit, non-ATPase 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001271779.1 | Intron | NP_001258708.1 | ||||
NM_001271780.1 | Intron | NP_001258709.1 | ||||
NM_001271781.1 | Intron | NP_001258710.1 | ||||
NM_014814.2 | Intron | NP_055629.1 | ||||
XM_005265619.1 | Intron | XP_005265676.1 | ||||
XM_011534288.1 | Intron | XP_011532590.1 | ||||
XM_017007569.1 | Intron | XP_016863058.1 |
PSMD6-AS2 - PSMD6 antisense RNA 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |