Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTCCCGCAGAAGACATCCCGGCACA[G/T]CAGCGGGGGAGGCGGAGGAGGCGCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600328 | ||||||||||||||||||||
Literature Links: |
LOC105371763 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC105371763 - uncharacterized LOC105371763 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR4726 - microRNA 4726 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR4734 - microRNA 4734 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MLLT6 - MLLT6, PHD finger domain containing | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005937.3 | 582 | Missense Mutation | AGC,ATC | S,I 190 | NP_005928.2 | |
XM_006721911.2 | 582 | Missense Mutation | AGC,ATC | S,I 190 | XP_006721974.1 | |
XM_017024648.1 | 582 | UTR 5 | XP_016880137.1 | |||
XM_017024649.1 | 582 | Missense Mutation | AGC,ATC | S,I 190 | XP_016880138.1 | |
XM_017024650.1 | 582 | Missense Mutation | AGC,ATC | S,I 190 | XP_016880139.1 |