Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCGCTAGCAGACAGGATAGCCGCAA[C/G]TTGTGATGCTTTGTTAATTCTTTTT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 611184 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CTU2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CTU2 - cytosolic thiouridylase subunit 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001012759.2 | Intron | NP_001012777.1 | ||||
NM_001012762.2 | Intron | NP_001012780.1 | ||||
NM_001318507.1 | Intron | NP_001305436.1 | ||||
NM_001318513.1 | Intron | NP_001305442.1 | ||||
XM_017023210.1 | Intron | XP_016878699.1 |
MIR4722 - microRNA 4722 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PIEZO1 - piezo type mechanosensitive ion channel component 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RNF166 - ring finger protein 166 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001171815.1 | Intron | NP_001165286.1 | ||||
NM_001171816.1 | Intron | NP_001165287.1 | ||||
NM_178841.3 | Intron | NP_849163.1 | ||||
XM_011522845.2 | Intron | XP_011521147.1 | ||||
XM_011522846.1 | Intron | XP_011521148.1 | ||||
XM_011522847.1 | Intron | XP_011521149.1 | ||||
XM_017022910.1 | Intron | XP_016878399.1 | ||||
XM_017022911.1 | Intron | XP_016878400.1 | ||||
XM_017022912.1 | Intron | XP_016878401.1 | ||||
XM_017022913.1 | Intron | XP_016878402.1 |