Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCGCAGTTTCTGGCCTTCCTGGAGC[A/C]ACACTGTTCCATCACCACCGAGACT
Species: |
Human | |||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 612195 MIM: 606137 MIM: 606395 | |||||||||||||||||||||||||||||||||||||||||
Literature Links: |
ABHD1 PubMed Links | |||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | ||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | ||||||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | ||||||
EUR
|
||||||||
AMR
|
ABHD1 - abhydrolase domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_032604.3 | 321 | Missense Mutation | CAA,CCA | Q,P 54 | NP_115993.3 | |
XM_011533135.2 | 321 | Missense Mutation | CAA,CCA | Q,P 54 | XP_011531437.1 | |
XM_011533136.2 | 321 | Missense Mutation | CAA,CCA | Q,P 54 | XP_011531438.1 | |
XM_011533137.2 | 321 | Missense Mutation | CAA,CCA | Q,P 54 | XP_011531439.1 | |
XM_011533138.2 | 321 | Intron | XP_011531440.1 | |||
XM_017005113.1 | 321 | Missense Mutation | CAA,CCA | Q,P 54 | XP_016860602.1 |
CGREF1 - cell growth regulator with EF-hand domain 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PREB - prolactin regulatory element binding | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRR30 - proline rich 30 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |