Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGCCTCCTGCTGTGTTCCAGGTTG[C/G]GGGGAGTTGGAGCCACAAATAGATG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 159555 MIM: 613934 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
KMT2A PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
KMT2A - lysine methyltransferase 2A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC101929089 - uncharacterized LOC101929089 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM25 - transmembrane protein 25 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001144034.1 | 133 | Missense Mutation | TGC,TGG | C,W 25 | NP_001137506.1 | |
NM_001144035.1 | 133 | Missense Mutation | TGC,TGG | C,W 25 | NP_001137507.1 | |
NM_001144036.1 | 133 | Intron | NP_001137508.1 | |||
NM_001144037.1 | 133 | Missense Mutation | TGC,TGG | C,W 25 | NP_001137509.1 | |
NM_001144038.1 | 133 | Missense Mutation | TGC,TGG | C,W 25 | NP_001137510.1 | |
NM_001318755.1 | 133 | Missense Mutation | TGC,TGG | C,W 25 | NP_001305684.1 | |
NM_001318757.1 | 133 | Missense Mutation | TGC,TGG | C,W 25 | NP_001305686.1 | |
NM_032780.3 | 133 | Missense Mutation | TGC,TGG | C,W 25 | NP_116169.2 | |
XM_005271703.1 | 133 | Missense Mutation | TGC,TGG | C,W 25 | XP_005271760.1 | |
XM_006718926.2 | 133 | Missense Mutation | TGC,TGG | C,W 25 | XP_006718989.1 | |
XM_006718927.2 | 133 | Missense Mutation | TGC,TGG | C,W 25 | XP_006718990.1 | |
XM_011543037.2 | 133 | Missense Mutation | TGC,TGG | C,W 25 | XP_011541339.1 | |
XM_011543038.2 | 133 | Missense Mutation | TGC,TGG | C,W 25 | XP_011541340.1 | |
XM_017018422.1 | 133 | Missense Mutation | TGC,TGG | C,W 25 | XP_016873911.1 | |
XM_017018423.1 | 133 | Missense Mutation | TGC,TGG | C,W 25 | XP_016873912.1 | |
XM_017018424.1 | 133 | Intron | XP_016873913.1 | |||
XM_017018425.1 | 133 | Intron | XP_016873914.1 | |||
XM_017018426.1 | 133 | Missense Mutation | TGC,TGG | C,W 25 | XP_016873915.1 | |
XM_017018427.1 | 133 | Intron | XP_016873916.1 | |||
XM_017018428.1 | 133 | Intron | XP_016873917.1 | |||
XM_017018429.1 | 133 | Intron | XP_016873918.1 | |||
XM_017018430.1 | 133 | Missense Mutation | TGC,TGG | C,W 25 | XP_016873919.1 | |
XM_017018431.1 | 133 | Missense Mutation | TGC,TGG | C,W 25 | XP_016873920.1 | |
XM_017018432.1 | 133 | Intron | XP_016873921.1 | |||
XM_017018433.1 | 133 | Intron | XP_016873922.1 |
TTC36 - tetratricopeptide repeat domain 36 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |