Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCCCCCAGCATTTCGTGGGTGGGGA[C/G]TGAAGATAGGTTTTCTTCGTTGTCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 300682 MIM: 300865 | ||||||||||||||||||||
Literature Links: |
LINC00629 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LINC00629 - long intergenic non-protein coding RNA 629 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR424 - microRNA 424 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR450A1 - microRNA 450a-1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR450A2 - microRNA 450a-2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR450B - microRNA 450b | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR503 - microRNA 503 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR503HG - MIR503 host gene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR542 - microRNA 542 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |