Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTTATTGGGCATGCGTCAGTCAGAG[C/G]CTGGGCTGGCCAGGGTCGGGTAGGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 603832 MIM: 606862 MIM: 606419 MIM: 609519 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
NDUFA3 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
NDUFA3 - NADH:ubiquinone oxidoreductase subunit A3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004542.3 | 764 | Intron | NP_004533.1 | |||
XM_017026833.1 | 764 | Intron | XP_016882322.1 |
OSCAR - osteoclast associated, immunoglobulin-like receptor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRPF31 - pre-mRNA processing factor 31 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TFPT - TCF3 fusion partner | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001321792.1 | 764 | Missense Mutation | GCC,GGC | A,G 242 | NP_001308721.1 | |
NM_013342.3 | 764 | Missense Mutation | GCC,GGC | A,G 251 | NP_037474.1 | |
XM_005278261.1 | 764 | Missense Mutation | GCC,GGC | A,G 131 | XP_005278318.1 |