Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCCAACCTCCGACTGTGTGTCCTTC[A/G]GGACCCGAAACCATGGCCCACACTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 616587 MIM: 613622 MIM: 182180 | ||||||||||||||||||||
Literature Links: |
FAM118B PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FAM118B - family with sequence similarity 118 member B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FOXRED1 - FAD dependent oxidoreductase domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_017547.3 | 296 | Intron | NP_060017.1 | |||
XM_006718879.3 | 296 | Intron | XP_006718942.1 | |||
XM_006718881.3 | 296 | Intron | XP_006718944.1 | |||
XM_011542895.2 | 296 | Intron | XP_011541197.1 | |||
XM_011542896.2 | 296 | Intron | XP_011541198.1 | |||
XM_017018000.1 | 296 | Intron | XP_016873489.1 | |||
XM_017018001.1 | 296 | UTR 5 | XP_016873490.1 | |||
XM_017018002.1 | 296 | Intron | XP_016873491.1 | |||
XM_017018003.1 | 296 | Intron | XP_016873492.1 | |||
XM_017018004.1 | 296 | Intron | XP_016873493.1 | |||
XM_017018005.1 | 296 | Intron | XP_016873494.1 | |||
XM_017018006.1 | 296 | Intron | XP_016873495.1 |
SRPRA - SRP receptor alpha subunit | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001177842.1 | 296 | Intron | NP_001171313.1 | |||
NM_003139.3 | 296 | Intron | NP_003130.2 | |||
XM_017018179.1 | 296 | Intron | XP_016873668.1 |