Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACCCAAAAGGCGTGCTCCCCACCGC[A/C]AGCGTGCGCTGCCCACCTGCACCAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605759 | ||||||||||||||||||||
Literature Links: |
ASB2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ASB2 - ankyrin repeat and SOCS box containing 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001202429.1 | Intron | NP_001189358.1 | ||||
NM_016150.4 | Intron | NP_057234.2 | ||||
XM_005267758.3 | Intron | XP_005267815.1 | ||||
XM_011536834.2 | Intron | XP_011535136.1 | ||||
XM_011536835.2 | Intron | XP_011535137.1 | ||||
XM_017021369.1 | Intron | XP_016876858.1 |
FAM181A - family with sequence similarity 181 member A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR4506 - microRNA 4506 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |