Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCGGGAACGGGAGGGGCCTGGAGAA[T/G]CAGCCCTGCTCACTCCCTCCTCTGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 182381 MIM: 602353 | ||||||||||||||||||||
Literature Links: |
C16orf58 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C16orf58 - chromosome 16 open reading frame 58 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC105371171 - uncharacterized LOC105371171 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC5A2 - solute carrier family 5 member 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003041.3 | Intron | NP_003032.1 |
TGFB1I1 - transforming growth factor beta 1 induced transcript 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |