Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACGAAGGAGGTTGACACCAACGTGG[A/C]CACCGGCGCCCCTCCACGCCGCCAA
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 120810 MIM: 605996 MIM: 600478 MIM: 604977 | |||||||||||||||||||||||
Literature Links: |
C4A PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU)
|
|||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
C4A - complement component 4A (Rodgers blood group) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
DXO - decapping exoribonuclease | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005510.3 | 244 | UTR 5 | NP_005501.2 | |||
XM_006715005.3 | 244 | UTR 5 | XP_006715068.1 | |||
XM_017010329.1 | 244 | UTR 5 | XP_016865818.1 |
SKIV2L - Ski2 like RNA helicase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
STK19 - serine/threonine kinase 19 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004197.1 | 244 | Missense Mutation | GAC,GCC | D,A 39 | NP_004188.1 | |
NM_032454.1 | 244 | Missense Mutation | GAC,GCC | D,A 39 | NP_115830.1 |
Set Membership: |
HapMap |